View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0541_low_15 (Length: 359)

Name: NF0541_low_15
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0541_low_15
NF0541_low_15
[»] chr3 (1 HSPs)
chr3 (13-206)||(30652586-30652779)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 30652779 - 30652586
Alignment:
13 aatatctcaacaaaaagagtagatctgtgttgtgagttgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa 112  Q
    ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30652779 aatatctcaacaaaaagagtagagctgtgttgtgaggtgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa 30652680  T
113 acaatcaaagggctcctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgt 206  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30652679 acaatcaaagggcttctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgt 30652586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 845 times since January 2019
Visitors: 3657