View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_22 (Length: 312)
Name: NF0541_low_22
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 68 - 233
Target Start/End: Complemental strand, 26001086 - 26000922
Alignment:
| Q |
68 |
aggagcagagagtagagtatgaaatgcttatgctgcacaacgggataaagaagtgttgaaatgaaaatataggtagtgctggcgtattaagactctatct |
167 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26001086 |
aggagaagagagtagagtatgaaatgcttatgctgcacaacgggataaagaagtgttgaaatgaaaatataggtagtgctggcgtatt-agactctatct |
26000988 |
T |
 |
| Q |
168 |
tgctcgacaattattgttttgattatatatatttcttacatctcattttaaatgtctcgtaaataa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26000987 |
tgctcgacaattattgttttgattatatatatttcttacatctcattttaaatgtctcctaaataa |
26000922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 26000918 - 26000870
Alignment:
| Q |
264 |
tttattattatattcgtgtttattgaattttgttcaacttaactattct |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
26000918 |
tttattattatattcgtatttattgaatttcgttcaatttaactattct |
26000870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University