View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_29 (Length: 261)
Name: NF0541_low_29
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 261
Target Start/End: Complemental strand, 46895204 - 46894973
Alignment:
| Q |
30 |
tctcattgttgttctcaaacccttttctactttccgtttcattcttcatttccaacttcactccaaaaatctcaagttgatggagccagaaccagcaaac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46895204 |
tctcattgttgttctcaaacccttttctactttccctttcattcttcatttccaacttcactccaaaaatctcaagttgatggagccagaaccagcaaac |
46895105 |
T |
 |
| Q |
130 |
tctgtggctagcaatggtggcagcaactcgtcaaatcttgttgcgccggtggcacctgaacaatccggcgaaggtttaccctatgcgccggagaattttc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46895104 |
tctgtggctagcaatggtggcagcaactcgtcaaatcttgttgcgccggtggcacctgaacaatccggcgaaggtttaccctatgcgccggagaattttc |
46895005 |
T |
 |
| Q |
230 |
cgaatcccggtgacatttggcgatggaaatcc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46895004 |
cgaatcccggtgacatttggcgatggaaatcc |
46894973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University