View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0541_low_29 (Length: 261)

Name: NF0541_low_29
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0541_low_29
NF0541_low_29
[»] chr1 (1 HSPs)
chr1 (30-261)||(46894973-46895204)


Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 261
Target Start/End: Complemental strand, 46895204 - 46894973
Alignment:
30 tctcattgttgttctcaaacccttttctactttccgtttcattcttcatttccaacttcactccaaaaatctcaagttgatggagccagaaccagcaaac 129  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46895204 tctcattgttgttctcaaacccttttctactttccctttcattcttcatttccaacttcactccaaaaatctcaagttgatggagccagaaccagcaaac 46895105  T
130 tctgtggctagcaatggtggcagcaactcgtcaaatcttgttgcgccggtggcacctgaacaatccggcgaaggtttaccctatgcgccggagaattttc 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46895104 tctgtggctagcaatggtggcagcaactcgtcaaatcttgttgcgccggtggcacctgaacaatccggcgaaggtttaccctatgcgccggagaattttc 46895005  T
230 cgaatcccggtgacatttggcgatggaaatcc 261  Q
    ||||||||||||||||||||||||||||||||    
46895004 cgaatcccggtgacatttggcgatggaaatcc 46894973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 786 times since January 2019
Visitors: 3656