View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_30 (Length: 253)
Name: NF0541_low_30
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 165 - 243
Target Start/End: Original strand, 19388547 - 19388625
Alignment:
| Q |
165 |
gactattaatcttgctgcgatttgcacaccggcggattataacacgcggcctttggatactatttacagtaatttcatc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19388547 |
gactattaatcttgctgcgatttgcacaccggcggattataacacgcggcctttggatactatttacagtaatttcatc |
19388625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 19388383 - 19388440
Alignment:
| Q |
1 |
aatatcaagaacgattctcgtcttgaaactcttgtcaaagcttctgatctcgtatata |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19388383 |
aatatcaagaacgattctcgtcttgaaactcttgtcaaagcttctgatctcgtatata |
19388440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University