View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_31 (Length: 253)
Name: NF0541_low_31
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 30 - 244
Target Start/End: Original strand, 5511351 - 5511565
Alignment:
| Q |
30 |
ggtgtgactagttcaaccggtaaatctaattaatatgcttaaaacattatactataaagaagtggtttaccctaaagtagaatttttatctttctatcaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5511351 |
ggtgtgactagttcaaccggtaaatctaattaatatgcttaaaacattatactataaaggagtggtttaccctaaagtagaatttttatctttctatcaa |
5511450 |
T |
|
| Q |
130 |
aagnnnnnnnnctgagaatttctatctatctactactattatacagcattgaagcaataatgtcaatttgtcaaaatgacccgtgggctataaactctgg |
229 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5511451 |
aagaaaaaaaactgagaatttctatctatctactactattatacagcattgaagcaataatgtcaatttgtcaaaatgacccgtgggctataaactctgg |
5511550 |
T |
|
| Q |
230 |
cattcatagaataat |
244 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
5511551 |
cattcatagtataat |
5511565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 847 times since January 2019
Visitors: 3657