View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_35 (Length: 249)
Name: NF0541_low_35
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 2 - 238
Target Start/End: Original strand, 23360774 - 23361012
Alignment:
| Q |
2 |
acattttacttacatgtagtagtaactcattcactttactctctgttcctc--acaattcaggtttattcaaagaagagaaatgtcggtgacttcaagct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23360774 |
acattttacttacatgtagtagtaactcactcactttactctctgttcctctcacaattcaggttttttcaaagaagagaaatgtcggtgacttcaagct |
23360873 |
T |
|
| Q |
100 |
ctagaggaagaccaggtaccagagaaactagcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttacta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23360874 |
ctagaggaagaccaggtaccagagaaactagcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttacta |
23360973 |
T |
|
| Q |
200 |
cctctcacgtaatggccaccttgagcacccccatttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23360974 |
cctctcacgtaatggccaccttgaacacccccatttcat |
23361012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1781 times since January 2019
Visitors: 3673