View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_43 (Length: 228)
Name: NF0541_low_43
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_43 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 60 - 209
Target Start/End: Complemental strand, 28960 - 28811
Alignment:
| Q |
60 |
atcataggcatggagaggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatgggcaaggtttcatgtctgttcaattgactagaaca |
159 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28960 |
atcaaaggcatggagaggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaaca |
28861 |
T |
 |
| Q |
160 |
gatgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28860 |
gatgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaac |
28811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University