View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_47 (Length: 227)
Name: NF0541_low_47
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0541_low_47 |
 |  |
|
[»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 50 - 197
Target Start/End: Original strand, 28811 - 28958
Alignment:
Q |
50 |
gttttgtgcaaaacctggccagaaacatcatagaacacaatgtttgcatctgttctagtcaattgaacagacatgaaaccttgtccatcatagaagaaat |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28811 |
gttttgtgcaaaacctggccagaaacatcatagaacacaatgtttgcatctgttctagtcaattgaacagacatgaaaccttgtccatcatagaagaaat |
28910 |
T |
 |
Q |
150 |
ttacaccgtttccggtagtttctcgaacatctcctctccatgcctttg |
197 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
28911 |
ttacaccgtttccggtagtttctcgaacgtctcctctccatgcctttg |
28958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University