View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_48 (Length: 227)
Name: NF0541_low_48
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0541_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 45345232 - 45345308
Alignment:
Q |
1 |
catgggcatcaaagaagcagcctgttgtaacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgct |
77 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45345232 |
catgggcatcaaagaagcagcctgttgtaacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgct |
45345308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1167 times since January 2019
Visitors: 3663