View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_56 (Length: 208)
Name: NF0541_low_56
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0541_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 187
Target Start/End: Original strand, 6270566 - 6270725
Alignment:
Q |
28 |
gagcagagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg |
127 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6270566 |
gagccgagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg |
6270665 |
T |
 |
Q |
128 |
ggttgaggaagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggattt |
187 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6270666 |
ggttgagggagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggattt |
6270725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 149
Target Start/End: Original strand, 6261600 - 6261660
Alignment:
Q |
89 |
ttttggagggatgaagattggcgttggtggtgttgggtgggttgaggaagctgtgaggtct |
149 |
Q |
|
|
|||||| | ||||||||||||||| || |||| |||||||| ||||||||||||||||| |
|
|
T |
6261600 |
ttttggtgagatgaagattggcgtgggaggtggagggtgggtgcaggaagctgtgaggtct |
6261660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 23 times since January 2019
Visitors: 3673