View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0541_low_56 (Length: 208)

Name: NF0541_low_56
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0541_low_56
NF0541_low_56
[»] chr1 (2 HSPs)
chr1 (28-187)||(6270566-6270725)
chr1 (89-149)||(6261600-6261660)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 187
Target Start/End: Original strand, 6270566 - 6270725
Alignment:
28 gagcagagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg 127  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6270566 gagccgagatgacggagcggtttgaccggattgaggagtcgaaccggaggatggagcggttttttggagggatgaagattggcgttggtggtgttgggtg 6270665  T
128 ggttgaggaagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggattt 187  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
6270666 ggttgagggagctgtgaggtctagtgaggaagatgagggtagtttggggaatttggattt 6270725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 149
Target Start/End: Original strand, 6261600 - 6261660
Alignment:
89 ttttggagggatgaagattggcgttggtggtgttgggtgggttgaggaagctgtgaggtct 149  Q
    |||||| | ||||||||||||||| || ||||  ||||||||  |||||||||||||||||    
6261600 ttttggtgagatgaagattggcgtgggaggtggagggtgggtgcaggaagctgtgaggtct 6261660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University