View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_8 (Length: 427)
Name: NF0541_low_8
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 97 - 416
Target Start/End: Complemental strand, 38048171 - 38047852
Alignment:
| Q |
97 |
aacgagagtagggattcagaattgaagaaaggatggatggaaaactctttgtcctctatatcaactccacctcttcagcttttggccttagttggtatag |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38048171 |
aacgagagtagggatttagaattgaagaaaggatggatggaaaactctttgtcctctatatcaactccacctcttcagcttttggccttagttggtatag |
38048072 |
T |
 |
| Q |
197 |
ttgtgttcttattgtggatttcatcatatatgaacatgcaatcaactagcacaaacctcaacttgttcctcttgtttttgacacttctcattacactcat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38048071 |
ttgtgttcttattgtggatttcatcatatatgaacatgcaatcaactagcacaaacctcaacttgttcctcttgtttttgacacttctcattacactcat |
38047972 |
T |
 |
| Q |
297 |
ctctctatttggacgatacatggctccagcatcaaattcaaatgttatagaaggtggagatgatggggttcaatccacttggggatcagttgctttgctt |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38047971 |
ctctctatttggacgatacatggctccagcatcaaattcaaatgttatagaaggtggagatgatggggttcaatccacttggggatcagttgctttgctt |
38047872 |
T |
 |
| Q |
397 |
gtgtttcttttggttttcat |
416 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38047871 |
gtgtttcttttggttttcat |
38047852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University