View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_high_24 (Length: 292)
Name: NF0542_high_24
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 30 - 163
Target Start/End: Original strand, 34175213 - 34175346
Alignment:
Q |
30 |
aaatggataattttgtgagttgatttgtcaccaccatgatttcttgcttggattgcactagtcgagataagttgaatgcctgtcataattagtgaatcaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34175213 |
aaatggataattttgtgagttgatttgtcaccaccatgatttcttgcttggattgcactagtcgagataagttgaatgcctgtcataattagtgaatcaa |
34175312 |
T |
 |
Q |
130 |
gttgatgaatggaatgagatgtgatgagaggagc |
163 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
34175313 |
gttgatgaatggaatgagatgtgatgagaggagc |
34175346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 222 - 292
Target Start/End: Original strand, 34175418 - 34175488
Alignment:
Q |
222 |
taatcaaattttattaaaaccacatacacctcaatacctcataggacaggtaaggttacggaggtgccaaa |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
34175418 |
taatcaaattttattaaaaccacatacacctcaatacctcataggagaggtaaggttacggaggtgccaaa |
34175488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 39076334 - 39076419
Alignment:
Q |
30 |
aaatggataattttgtgagttgatttgtcaccaccatgatttcttgcttggattgcactagtcgagataagttgaatgcctgtcat |
115 |
Q |
|
|
|||| ||||||| |||||||||| |||||| || |||| ||| |||||||||||| | |||| ||||||| | |||| |||||||| |
|
|
T |
39076334 |
aaatcgataattgtgtgagttgagttgtcatcaacatgtttttttgcttggattgtagtagttgagataactagaatccctgtcat |
39076419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 562 times since January 2019
Visitors: 3653