View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_high_29 (Length: 260)
Name: NF0542_high_29
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 40471855 - 40472076
Alignment:
Q |
30 |
ttctattcatgattgtgttgtgtctttctcttttagttatctttttctccaccttctatttttgttgttctgtaaatgtagtccaccttatgaacacgag |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40471855 |
ttctattcatgattgtgttgtgtctttctcttttagttatctttttctccaccttctatttttgttggtctgtaaatgtagtccaccttatgaacacgag |
40471954 |
T |
 |
Q |
130 |
ttgcttttgctgtaatttcccattttcctttgggaggtttgtaatgtgtttgtcttctaagatgtgaaccatttaacgaatccatgatcattgtacactg |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40471955 |
ttgcttttgctgtaatttcccattttcctttgggaggtttgtaatgtgtttgtcttctaaggtgtgaaccatttaacgaatctatgatcattgtacactg |
40472054 |
T |
 |
Q |
230 |
ctgcaaaaattcccttttgagg |
251 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
40472055 |
ctgcaaaaattcccttttgagg |
40472076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University