View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0542_high_40 (Length: 216)

Name: NF0542_high_40
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0542_high_40
NF0542_high_40
[»] chr2 (1 HSPs)
chr2 (18-123)||(10299150-10299255)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 10299150 - 10299255
Alignment:
18 aaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgatgtataaattacatattagaggattcaatccacccttctcc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
10299150 aaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgatgtataaattacatattagaggattcattccacccttctcc 10299249  T
118 cacaac 123  Q
     |||||    
10299250 aacaac 10299255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 129 times since January 2019
Visitors: 3674