View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_high_40 (Length: 216)
Name: NF0542_high_40
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0542_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 10299150 - 10299255
Alignment:
| Q |
18 |
aaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgatgtataaattacatattagaggattcaatccacccttctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10299150 |
aaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgatgtataaattacatattagaggattcattccacccttctcc |
10299249 |
T |
|
| Q |
118 |
cacaac |
123 |
Q |
| |
|
||||| |
|
|
| T |
10299250 |
aacaac |
10299255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 129 times since January 2019
Visitors: 3674