View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_15 (Length: 399)
Name: NF0542_low_15
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 97 - 364
Target Start/End: Complemental strand, 28499451 - 28499184
Alignment:
Q |
97 |
aataatttctatttaagagaatggcaattcataacaaatgttcttttatacacgtatgaatatgaattctctgcctccatgagaccctgcaattgtagtc |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| |
|
|
T |
28499451 |
aataatttctatttaagagaatggcaattcatcacaaatgttcttttatacacgtatgaatatgaattttctgcctccatgagaccctgcaactgt-gtc |
28499353 |
T |
 |
Q |
197 |
atgaatat-aatcattaggtaacgagcccaaattgatttcagacaagtagaatttattttgatagagctagatattctccaatagaattaattttgcata |
295 |
Q |
|
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28499352 |
atgaatattaatcattaggtaacgagtccaaattgatttcagacaagtagaatttattttgatagagctagatattctccaatagaattaattttgcata |
28499253 |
T |
 |
Q |
296 |
tagaattagtgtatatacttatattcaaattcaatttgacaaaataacagtgacaccacgattttgttg |
364 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
T |
28499252 |
tagaattagtgtatatacttatattcaaattcaatttaataaaataagagtgacaccacgattttgttg |
28499184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 649 times since January 2019
Visitors: 3655