View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_22 (Length: 325)
Name: NF0542_low_22
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0542_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 30 - 286
Target Start/End: Original strand, 38077836 - 38078094
Alignment:
| Q |
30 |
atatccagtctagaacaaatttaattttgtactatcgtgaaagtaatcatctcccagacacagcataaactgaactactctgcttgaaacaaataatcca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38077836 |
atatccagtctagaacaaatttaattttgtactatcgtgaaagtaatcatctcccagacacagcataaactgaactactctgcttgaaacaaataatcca |
38077935 |
T |
|
| Q |
130 |
acacacctagtgtatgtactatgtatatttgtcgtgtttgtgcaaatatctttgacgacttttacacagtcatacacacatgtatatgcccgtttattta |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38077936 |
acacacctagtg-------tatgtatatttgtcgtgtttgtgcaaatatctttgacgacttttacacagtcatacacacatgtatatgtccgtttattta |
38078028 |
T |
|
| Q |
230 |
tatccttgaattaa---------agtcagaatattacacgcaactaatgatgatatgtcatgtcat |
286 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38078029 |
tatccttgaattaatgaatatagagtcagaatattacacgcaactaatgataatatgtcatgtcat |
38078094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 907 times since January 2019
Visitors: 3660