View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_24 (Length: 321)
Name: NF0542_low_24
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0542_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 150 - 294
Target Start/End: Complemental strand, 2618558 - 2618414
Alignment:
| Q |
150 |
ctagtctaatgcaatttacagctagaaacaaagctaacaacnnnnnnnccttttgtaatgttatattttgttttttgttatgaattagattaaatcagat |
249 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618558 |
ctagcctaatgcaatttacagctaaaaacaaagctaacaacaaaaaaaccttttgtaatgttatattttgttttttgttatgaattagattaaatcagat |
2618459 |
T |
 |
| Q |
250 |
cttgtagaattgttgaggtacatgacaacacacaatgtacgaggt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618458 |
cttgtagaattgttgaggtacatgacaacacacaatgtacgaggt |
2618414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 64
Target Start/End: Complemental strand, 2618675 - 2618640
Alignment:
| Q |
29 |
aggtcgttgttgtgttgtaggattcactaaggttgg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618675 |
aggtcgttgttgtgttgtaggattcactaaggttgg |
2618640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University