View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0542_low_31 (Length: 289)

Name: NF0542_low_31
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0542_low_31
NF0542_low_31
[»] chr5 (1 HSPs)
chr5 (68-242)||(10420692-10420866)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 68 - 242
Target Start/End: Complemental strand, 10420866 - 10420692
Alignment:
Q  68 gattttttatacgtttgcatgcagtacatgacacatgcacggggtgtagttgataacctacttcgtgtcaaattcaaacacaatgtaactcaaagcaaga 167  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10420866 gattttttatacgtttgcatgcggtacatgacacatgcacggggtgtagttgataacctacttcgtgtcaaattcaaacacaatgtaactcaaagcaaga 10420767  T
Q  168 gtaacgtatatttcagctgttagcttattcaacattaacaaatatctatgttctatcaaagaaaatatctctgct 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  10420766 gtaacgtatatttcagctgttagcttattcaacattaacaaatatctatgttctatcaaagaaaatatcgctgct 10420692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University