View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_31 (Length: 289)
Name: NF0542_low_31
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 68 - 242
Target Start/End: Complemental strand, 10420866 - 10420692
Alignment:
Q |
68 |
gattttttatacgtttgcatgcagtacatgacacatgcacggggtgtagttgataacctacttcgtgtcaaattcaaacacaatgtaactcaaagcaaga |
167 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10420866 |
gattttttatacgtttgcatgcggtacatgacacatgcacggggtgtagttgataacctacttcgtgtcaaattcaaacacaatgtaactcaaagcaaga |
10420767 |
T |
 |
Q |
168 |
gtaacgtatatttcagctgttagcttattcaacattaacaaatatctatgttctatcaaagaaaatatctctgct |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
10420766 |
gtaacgtatatttcagctgttagcttattcaacattaacaaatatctatgttctatcaaagaaaatatcgctgct |
10420692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University