View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0542_low_33 (Length: 275)

Name: NF0542_low_33
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0542_low_33
NF0542_low_33
[»] chr1 (1 HSPs)
chr1 (52-189)||(13298704-13298841)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 52 - 189
Target Start/End: Complemental strand, 13298841 - 13298704
Alignment:
52 agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaagttgtttgtttatttatttcaataatttaaca 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
13298841 agagagaaggataggcgccatgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaaattgtttgtttatttatttcaataatttaaca 13298742  T
152 gtccatgtatatatgtgaaaattgtatggatactgaac 189  Q
    |||||| |||||||||||||||||||||||||||||||    
13298741 gtccatttatatatgtgaaaattgtatggatactgaac 13298704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 116 times since January 2019
Visitors: 3647