View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_37 (Length: 262)
Name: NF0542_low_37
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 36460429 - 36460606
Alignment:
Q |
1 |
gatcttatttaagtcgaaaaattaatttctg----------acaactatccaattaataaaagnnnnnnntcaactccacttcacaataaaaatttcact |
90 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
36460429 |
gatcttatttaagtcgaaaaattaatttctacagttgtcatacaactatccaattaaaaaaagaaaaaaatcaactccacttcacaataaaaatttcact |
36460528 |
T |
 |
Q |
91 |
atgtatagaaaaataaggtctggtcaccttggattctcacacccctaccctcaaaccatccgctggtgtgcaatttgt |
168 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36460529 |
aagtatagaaaaataaggtctggtcaccttggattctcacacccctaccctcaaaccatccgctggtgtgcaatttgt |
36460606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 183 times since January 2019
Visitors: 3648