View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0542_low_46 (Length: 249)

Name: NF0542_low_46
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0542_low_46
NF0542_low_46
[»] chr2 (1 HSPs)
chr2 (10-249)||(39135165-39135402)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 39135165 - 39135402
Alignment:
10 aacaatatgaagaagttatattataatttagaggcaactttaatcaataatgataatcannnnnnnnnnnngaggggtcaataatgataatcattgttgt 109  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||              ||||||||||||||||||||||||||||    
39135165 aacaaaatgaagaagttatattataatttagaggcaactttaatcaataacgataatcgttttttttttt--aggggtcaataatgataatcattgttgt 39135262  T
110 ttatatgttactatgatttaattaatttctacaaccccacacattgtttgttcttatgaggaaattatttgcaattttggagtatcttttgtggacccca 209  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||    
39135263 ttatatgttactatgatttaattaatttctacaaccccgcacattgttttgttttatgaggaaattatttgcaattttggagtatcttttgtggacccca 39135362  T
210 cacctctacacaacaaactcattgctaccaaaaataacaa 249  Q
    |||||| |||||||||||||||||||||||||||||||||    
39135363 cacctccacacaacaaactcattgctaccaaaaataacaa 39135402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University