View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_46 (Length: 249)
Name: NF0542_low_46
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_low_46 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 39135165 - 39135402
Alignment:
Q |
10 |
aacaatatgaagaagttatattataatttagaggcaactttaatcaataatgataatcannnnnnnnnnnngaggggtcaataatgataatcattgttgt |
109 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
T |
39135165 |
aacaaaatgaagaagttatattataatttagaggcaactttaatcaataacgataatcgttttttttttt--aggggtcaataatgataatcattgttgt |
39135262 |
T |
 |
Q |
110 |
ttatatgttactatgatttaattaatttctacaaccccacacattgtttgttcttatgaggaaattatttgcaattttggagtatcttttgtggacccca |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39135263 |
ttatatgttactatgatttaattaatttctacaaccccgcacattgttttgttttatgaggaaattatttgcaattttggagtatcttttgtggacccca |
39135362 |
T |
 |
Q |
210 |
cacctctacacaacaaactcattgctaccaaaaataacaa |
249 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
39135363 |
cacctccacacaacaaactcattgctaccaaaaataacaa |
39135402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 3672