View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0542_low_54 (Length: 217)

Name: NF0542_low_54
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0542_low_54
NF0542_low_54
[»] chr2 (2 HSPs)
chr2 (1-190)||(44565842-44566031)
chr2 (76-190)||(36034849-36034963)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 44566031 - 44565842
Alignment:
1 atattcgtccggttgataccatcatgtcacaatgcacgtgagaaattgccaggtcaaccccaaaaatacttaaaggcactatgtaaaactatttttccat 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44566031 atattcgtccggttgataccatcatatcacaatgcacgtgagaaattgccaggtcaaccccaaaaatacttaaaggcactatgtaaaactatttttccat 44565932  T
101 gttgtatttactaacattattcttcttttcagcataatctgctatgattctacttgaatttttcaaccattagcagttacctacattatg 190  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44565931 gttgtatttactaacattattcttcttttcagcattatctgctatgattctacttgaatttttcaaccattagcagttacctacattatg 44565842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 190
Target Start/End: Original strand, 36034849 - 36034963
Alignment:
76 gcactatgtaaaactatttttccatgttgtatttactaacattattcttcttttcagcataatctgctatgattctacttgaatttttcaaccattagca 175  Q
    |||||||| || |||||||| || |||||| |||||||||     | |||||  |||||| |||||||||  || ||||||||| | ||||||| ||| |    
36034849 gcactatgcaatactattttcccctgttgtttttactaacgcaggttttcttcccagcattatctgctatagttttacttgaatctctcaaccactagga 36034948  T
176 gttacctacattatg 190  Q
    |||||||||||||||    
36034949 gttacctacattatg 36034963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University