View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0542_low_54 (Length: 217)
Name: NF0542_low_54
Description: NF0542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0542_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 44566031 - 44565842
Alignment:
Q |
1 |
atattcgtccggttgataccatcatgtcacaatgcacgtgagaaattgccaggtcaaccccaaaaatacttaaaggcactatgtaaaactatttttccat |
100 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44566031 |
atattcgtccggttgataccatcatatcacaatgcacgtgagaaattgccaggtcaaccccaaaaatacttaaaggcactatgtaaaactatttttccat |
44565932 |
T |
 |
Q |
101 |
gttgtatttactaacattattcttcttttcagcataatctgctatgattctacttgaatttttcaaccattagcagttacctacattatg |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44565931 |
gttgtatttactaacattattcttcttttcagcattatctgctatgattctacttgaatttttcaaccattagcagttacctacattatg |
44565842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 190
Target Start/End: Original strand, 36034849 - 36034963
Alignment:
Q |
76 |
gcactatgtaaaactatttttccatgttgtatttactaacattattcttcttttcagcataatctgctatgattctacttgaatttttcaaccattagca |
175 |
Q |
|
|
|||||||| || |||||||| || |||||| ||||||||| | ||||| |||||| ||||||||| || ||||||||| | ||||||| ||| | |
|
|
T |
36034849 |
gcactatgcaatactattttcccctgttgtttttactaacgcaggttttcttcccagcattatctgctatagttttacttgaatctctcaaccactagga |
36034948 |
T |
 |
Q |
176 |
gttacctacattatg |
190 |
Q |
|
|
||||||||||||||| |
|
|
T |
36034949 |
gttacctacattatg |
36034963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University