View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543-Insertion-10 (Length: 85)
Name: NF0543-Insertion-10
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543-Insertion-10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 4244403 - 4244326
Alignment:
| Q |
8 |
gttgcttcatcacttaaaaccaacgttgagtttggtatcaaaagtcatgatgatgattttcatgacatttcaattaga |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244403 |
gttgcttcatcacttaaaaccaacgttgagtttggtatcagaagtcatgatgatgattttcatgacatttcaattaga |
4244326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 6187462 - 6187412
Alignment:
| Q |
8 |
gttgcttcatcacttaaaaccaacgttgagtttggtatcaaaagtcatgat |
58 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
6187462 |
gttgcttcatcacttaaaaccaacattgagtttggtatcaaaagtgatgat |
6187412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University