View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543-Insertion-11 (Length: 69)
Name: NF0543-Insertion-11
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0543-Insertion-11 |
 |  |
|
[»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 2e-27; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 48585861 - 48585800
Alignment:
Q |
8 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatcttcacca |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48585861 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatcttcacca |
48585800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 48640434 - 48640373
Alignment:
Q |
8 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatcttcacca |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48640434 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatcttcacca |
48640373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 48662068 - 48662007
Alignment:
Q |
8 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatcttcacca |
69 |
Q |
|
|
||||| |||| || |||||||||||| |||||||||||| |||||| |||| || ||||||| |
|
|
T |
48662068 |
aaaccctcttcttagactaggaaagtgtcttgctgcaaaaggtgcctctgtcattttcacca |
48662007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 48629372 - 48629316
Alignment:
Q |
8 |
aaaccatcttgttggactaggaaagtatcttgctgcaaagggtgccactgttatctt |
64 |
Q |
|
|
||||| |||| || |||||||||| | ||||||||||||||||||| |||| ||||| |
|
|
T |
48629372 |
aaaccctcttcttagactaggaaaatgtcttgctgcaaagggtgcctctgtcatctt |
48629316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University