View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543-Insertion-6 (Length: 410)
Name: NF0543-Insertion-6
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543-Insertion-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 26612875 - 26613027
Alignment:
| Q |
8 |
gacacacttcttcaagtgagacttactagattaactcagctgtcacttataatgtgatatgatatttccttcctacaaaaccattagcttctcttccttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26612875 |
gacacacttcttcaagtgagacttactagattaactcagctgtcacttataatgtgatatgatatttccttcctacaaaaccattagcttctcttccttc |
26612974 |
T |
 |
| Q |
108 |
tctctttggccagcaagcatattagtgtttgcttgcagctgtcacaacacatt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26612975 |
tctctttggccagcaagcatattagtgtttgcttgcagctgtcacaacacatt |
26613027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 262 - 410
Target Start/End: Original strand, 26613126 - 26613274
Alignment:
| Q |
262 |
aattaactaacacaacacatctgttccaaacaaccataccacatcatcatattcataaaccatacccacctctctcttttctcttaaaatttagtgattc |
361 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613126 |
aattaactaacacaacacatctgttccgaacaaccataccacatcatcatattcataaaccatacccacctctctcttttctcttaaaatttagtgattc |
26613225 |
T |
 |
| Q |
362 |
tctcctattgggaaaagaagaaagaggttttgttgaatggtggggttga |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613226 |
tctcctattgggaaaagaagaaagaggttttgttgaatggtggggttga |
26613274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University