View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_28 (Length: 298)
Name: NF0543_low_28
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0543_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 20025519 - 20025233
Alignment:
Q |
1 |
catggccgatgcagttgctggtgccgaaaagaagtattcagatggaagccttgcaacttccattgttagggaaattggaaggactaacccaaaagattat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20025519 |
catggccgatgcagttgctggtgccgaaaagaagtattcagatggaagccttgcaacttccattgttagggaaattggaaggactaacccaaaagattat |
20025420 |
T |
 |
Q |
101 |
gtcaaagacactattggtgctgaaaatgtggggcgttttcttgtggagttagctgaccgtattccaaaattgatatcaactaacattggcattcttgttc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20025419 |
gtcaaagacactattggtgctgaaaatgtggggcgttttcttgtggagttagctgaccgtattccaaaattgatatcaactaacattggcattcttgttc |
20025320 |
T |
 |
Q |
201 |
ctcactttggtggagagtcttataagattaggaatgctcttgtagctgtgctgggtaagctagtatcaaaagcgtttaaggatattg |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20025319 |
ctcactttggtggagagtcttataagattaggaatgctcttgtagctgtgctgggtaagctagtatcaaaagcgtttaaggatattg |
20025233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1533 times since January 2019
Visitors: 3672