View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_30 (Length: 283)
Name: NF0543_low_30
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 43 - 222
Target Start/End: Complemental strand, 42069679 - 42069500
Alignment:
| Q |
43 |
cataggcaagtctttttgatggggtgtgcttgcaccaaaccgcaatttcggcatgaagatccagcaattcttgctgaacaaacttattgtaagcttttta |
142 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069679 |
cataagcaagtctttttgatggggtgtgcttgcaccaaaccgcaatttcggcatgaagatccagcaattcttgctgaacaaacttattgtaagcttttta |
42069580 |
T |
 |
| Q |
143 |
tttctttccaatcatatcctggagtttgtattatagtatttcattgatgtgtcatgtcaatattgtagttgtgaagtatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069579 |
tttctttccaatcatatcctggagtttgtattatagtatttcattgatgtgtcatgtcaatattgtagttgtgaagtatt |
42069500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University