View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0543_low_30 (Length: 283)

Name: NF0543_low_30
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0543_low_30
NF0543_low_30
[»] chr8 (1 HSPs)
chr8 (43-222)||(42069500-42069679)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 43 - 222
Target Start/End: Complemental strand, 42069679 - 42069500
Alignment:
43 cataggcaagtctttttgatggggtgtgcttgcaccaaaccgcaatttcggcatgaagatccagcaattcttgctgaacaaacttattgtaagcttttta 142  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42069679 cataagcaagtctttttgatggggtgtgcttgcaccaaaccgcaatttcggcatgaagatccagcaattcttgctgaacaaacttattgtaagcttttta 42069580  T
143 tttctttccaatcatatcctggagtttgtattatagtatttcattgatgtgtcatgtcaatattgtagttgtgaagtatt 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42069579 tttctttccaatcatatcctggagtttgtattatagtatttcattgatgtgtcatgtcaatattgtagttgtgaagtatt 42069500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University