View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_31 (Length: 279)
Name: NF0543_low_31
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0543_low_31 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 12 - 279
Target Start/End: Original strand, 4996269 - 4996536
Alignment:
Q |
12 |
agagacaataacatagtcaacatgttcatcaaatcatctccaaaatgtttcacatctctctctagtactatacaaatttcataggttgtccaaatttctt |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4996269 |
agagacaataacatagtcaacatgttcatcaaatcatctccaaaatgtttcacatctctctctagtactatacaaatttcataggttgtccaaatttctt |
4996368 |
T |
 |
Q |
112 |
aaccttatcctatccccaagaatgattcttcttctggaagtaataatgctttaccccttacactctacctttggctgtgtcttgttcttcacttatggtt |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4996369 |
aaccttatcctatccccaagaatgattcttcttctggaagtaataatgctttaccccttacactctacctttggctgtgtcttgttcttcacttatggtt |
4996468 |
T |
 |
Q |
212 |
tctcatgcaaaattcttattgctttcaagtattcactttttcaacttttcaaaagaatccaaatctta |
279 |
Q |
|
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
4996469 |
tctcatgcaaaattcttattgatttcaagtaatcactttttcaacttttcaaaagaatccaaatctta |
4996536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1187 times since January 2019
Visitors: 3665