View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_33 (Length: 265)
Name: NF0543_low_33
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 47 - 174
Target Start/End: Complemental strand, 1411690 - 1411562
Alignment:
| Q |
47 |
atgatcgaaaagaggtgtcagtttcctccttattttctcaatgatcacttgatcagtggtgttctcaccataattgttcattgagggcactagtctttga |
146 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1411690 |
atgatcgaaaagaggtgtcattgtcctccttattttctcattgatcacttgatcagtggtgttctcaccataattgttcattgagggcactagtgtttga |
1411591 |
T |
|
| Q |
147 |
ag-ccttgccacatacacaacaatctttt |
174 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
1411590 |
agcccttgccacatacacaacaatctttt |
1411562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 200 - 253
Target Start/End: Complemental strand, 1411562 - 1411509
Alignment:
| Q |
200 |
tattgtcttctaagttattgcaatttccctttcttgactttgtcaccacgttca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1411562 |
tattgtcttctaagttattgcaatttccctttcttgactttgtcaccacgttca |
1411509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 484 times since January 2019
Visitors: 3651