View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_36 (Length: 260)
Name: NF0543_low_36
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 6 - 258
Target Start/End: Original strand, 45042086 - 45042338
Alignment:
| Q |
6 |
agtgagcttgagaatagactgctttcacgtgcgcctgcattggtgacaatcttgttcccaattaaaccatatgagctagatgctggctgcctatgcacat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45042086 |
agtgagcttgagaatagactgctttcacgtgcgcctgcattggtgacaatcttgttcccaattaaaccatatgagctagatgctggctgcctatgcacat |
45042185 |
T |
 |
| Q |
106 |
cagaccatgatctcgggtgataattcaatgattcctttgaatccttcagcgcatctaccatgccagcttgtgcaccaaagtgtacgttttctataacttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45042186 |
cagaccatgatctcgggtgataattcaatgattcctttgaatccttcagcgcatctaccatgccagcttgtgcaccaaagtgtacgttttctataacttc |
45042285 |
T |
 |
| Q |
206 |
cccagataaactagtctgtgacattggcaagcctattttttcatctcactcga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| || ||||| |
|
|
| T |
45042286 |
cccagataaactagtctgtgacattggcaagcctatttttgcatttctctcga |
45042338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University