View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_37 (Length: 260)
Name: NF0543_low_37
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0543_low_37 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 30 - 260
Target Start/End: Complemental strand, 45264403 - 45264173
Alignment:
| Q |
30 |
tgatggtgctctttgggacttaattatattataatacgaaattcgttttttatgggaaaatatttaatggttaatttgttaggaggagggaaatttgtta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264403 |
tgatggtgctctttgggacttaattatattataatacgaaattcgttttttatgggcaaatatttaatggttaatttgttaggaggagggaaatttgtta |
45264304 |
T |
|
| Q |
130 |
gggggagagatcaagcttgtaagttccggatccatacactaaaataaaggaagtagaacatttgttacaaggctaatatatttttgtgttttactccagc |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264303 |
gggggagagatcgagcttgtaagttccggatccatacactaaaataaaggaagtagaacatttgttacaaggctaatatatttttgtgttttactccaga |
45264204 |
T |
|
| Q |
230 |
gtgtgctcgttgtaaagtgtacactgcaaac |
260 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
45264203 |
gtgtgctcattgtaaagtgtacactgcaaac |
45264173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 541 times since January 2019
Visitors: 3653