View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0543_low_43 (Length: 248)
Name: NF0543_low_43
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0543_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 45042093 - 45042338
Alignment:
Q |
1 |
ttgagaatagactgctttcacgggcgcctgcattggtgacaatcttgttcccaattaaaccatatgagctagatgctggctgcctatgcacatcagacca |
100 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45042093 |
ttgagaatagactgctttcacgtgcgcctgcattggtgacaatcttgttcccaattaaaccatatgagctagatgctggctgcctatgcacatcagacca |
45042192 |
T |
 |
Q |
101 |
tgatctcgggtgataattcaatgattcctttgaatccttcagcgcatctaccatgccagcttgtgcaccaaagtgtacgttttctataacttccccagat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45042193 |
tgatctcgggtgataattcaatgattcctttgaatccttcagcgcatctaccatgccagcttgtgcaccaaagtgtacgttttctataacttccccagat |
45042292 |
T |
 |
Q |
201 |
aaactagtctgtgacattggcaagcctattttttcatctcactcga |
246 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| || ||||| |
|
|
T |
45042293 |
aaactagtctgtgacattggcaagcctatttttgcatttctctcga |
45042338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1806 times since January 2019
Visitors: 3673