View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_high_16 (Length: 274)
Name: NF0544_high_16
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0544_high_16 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 68 - 274
Target Start/End: Original strand, 41419167 - 41419360
Alignment:
Q |
68 |
ttgaatgtttattcagtagtcttgttatctttagtgaattagtaaataacaatactcatacatccacttcaattcctttatactatttgatatgtatcat |
167 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41419167 |
ttgaatgtttattcagtagtcttgttatctttagtgaatta-------------ctcatacatccacttcaattcctttatactatttgatatgtatcat |
41419253 |
T |
 |
Q |
168 |
tatcatactagtacaaatctaaagttgatttatctttaacagtttataaaacaacaataaaacatgtagaataattgaagaagtttattaacaattcatt |
267 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41419254 |
tatcatactagtacaaatctaaagttgatttatctttaacagtttataaaacaacaataaaacatgtagaataattgaagaagtttattaacaattcatt |
41419353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 170 times since January 2019
Visitors: 3674