View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_high_19 (Length: 222)
Name: NF0544_high_19
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 42850021 - 42849834
Alignment:
| Q |
1 |
gttgtgttccaagatccccatacgaggagctattagcaaggcctttaccttttctggtcattccttcagcaacggtgtaagcattcatcaaagaacctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42850021 |
gttgtgttccaagatccccatacgaggagctattagcaaggcctttaccttttctggtcattccttcagcaacggtgtaagcattcatcaaagaacctgc |
42849922 |
T |
|
| Q |
101 |
ggtatacaagcttcttgtggttgaggatttagacagtttttctttttcaagaacaccactaaactctgaactatgatctcttaattct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42849921 |
ggtatacaagcttcttgtggttgaggatttagacagtttttcttttccaagaacaccactaaactctgaactatgatctcttaattct |
42849834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1778 times since January 2019
Visitors: 3673