View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0544_high_2 (Length: 585)

Name: NF0544_high_2
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0544_high_2
NF0544_high_2
[»] chr1 (1 HSPs)
chr1 (11-137)||(14203287-14203416)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 11 - 137
Target Start/End: Original strand, 14203287 - 14203416
Alignment:
11 acaaaatagagaacgtgtcatttctgtctctgctactttctaatgatgcttaaaggctaaatccacttgccca---attattattatatcacgatcgttc 107  Q
    ||||||| || || ||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||   ||||||||||||||||||||||||    
14203287 acaaaatggataatgtgtcatttctgtctctactactttcttatgatgcttaaaggctaaagccacttgcccaattattattattatatcacgatcgttc 14203386  T
108 gaaagtggtgtgattttacggttctaataa 137  Q
    ||||||||||||||||||||||||||||||    
14203387 gaaagtggtgtgattttacggttctaataa 14203416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1549 times since January 2019
Visitors: 3672