View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_16 (Length: 374)
Name: NF0544_low_16
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 110 - 255
Target Start/End: Original strand, 39102579 - 39102718
Alignment:
| Q |
110 |
ttttgagagcattgagtcaagggtacttataaaatggatatcaaatgatactttaaaaaaaattcannnnnnnnnnnnnnnnnnnnnctgctaggagcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| |||| |
|
|
| T |
39102579 |
ttttgagagcattgagtcaagggtacttataaaatggatatcaaacgatacttt-aaaaaaattca-----ttttgtttttttttttctgctaggggcat |
39102672 |
T |
|
| Q |
210 |
ttaatcttaaatcaataaggacaaagaataagttcaccacattctg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39102673 |
ttaatcttaaatcaataaggacaaagaataagttcaccacattctg |
39102718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 65 - 98
Target Start/End: Original strand, 39102531 - 39102564
Alignment:
| Q |
65 |
catcatcttggtcccttacgtgccattgagtcgg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39102531 |
catcatcttggtcccttacgtgccattgagtcgg |
39102564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 331 - 363
Target Start/End: Original strand, 39102794 - 39102826
Alignment:
| Q |
331 |
tgatgttatatgtttcttaatttaattattcat |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39102794 |
tgatgttatatgtttcttaatttaattattcat |
39102826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1692 times since January 2019
Visitors: 3672