View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_18 (Length: 368)
Name: NF0544_low_18
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 30 - 201
Target Start/End: Complemental strand, 15129505 - 15129334
Alignment:
| Q |
30 |
tggtcaacctaacgcatactacattttggtattcataactttttaatgacaagtcgactattattatttcaagctcaaatttgaaaagaatattaacaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15129505 |
tggtcaacctaacgcatactacattttggtattcataactttttaatgacaagtagactattattatttcaagctcaaatttgaaaagaatattaacaca |
15129406 |
T |
 |
| Q |
130 |
aagatgagagtagtagacaattatattatgcagcaaaataatattgattgaatttggtgagaggaatctcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15129405 |
aagatgagagtagtagacaattatattatgcagcaaaataattttgattgaatttggtgagaggaatctcca |
15129334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 191
Target Start/End: Original strand, 5286430 - 5286535
Alignment:
| Q |
89 |
attattatttcaagctcaaatttgaaaagaatattaacacaaag---atgagagtagtagacaattatattatgcagcaaaataatattgattgaatttg |
185 |
Q |
| |
|
|||||||||| || |||||| || |||||||| ||||||| || || | |||||| ||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
5286430 |
attattatttgaacctcaaaattaaaaagaatcttaacactaatgaaattaaagtagtggacaattatcttatgcagcaagataatactgattgaatttg |
5286529 |
T |
 |
| Q |
186 |
gtgaga |
191 |
Q |
| |
|
||||| |
|
|
| T |
5286530 |
ctgaga |
5286535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University