View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_19 (Length: 358)
Name: NF0544_low_19
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_19 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 30 - 358
Target Start/End: Original strand, 13765979 - 13766307
Alignment:
| Q |
30 |
caaagatcaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatggtcgatattgatttcattcatatttc |
129 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13765979 |
caaagaacaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatgggcgatattgatttctttcatatttc |
13766078 |
T |
|
| Q |
130 |
taatttggataatgtcctgttgttagctctagtcttggtttcaaaaatggaattggtggtttctagtgtggatggtaacgagatccctataccggacgga |
229 |
Q |
| |
|
||||||||||||||| ||||||| ||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
13766079 |
taatttggataatgttctgttgtcagctcaattcttggtttcaaaaatggaattggtggtttctagtctggatggtaacgagagccctaggccggacgga |
13766178 |
T |
|
| Q |
230 |
tttaatctcaacttctttacacggttgcgaaatatgttgaaagctgatgtcaaggttatgtttgagcaattttatactccagcaaatctgcttaagatct |
329 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766179 |
tttaatctcaacttctttatacggttgcgaaatatgttgaaagctgacatcgagattatgtttgagcaattttatactccagcaaatctgcttaagatct |
13766278 |
T |
|
| Q |
330 |
tctcctaatactttgttaccttgatctct |
358 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
13766279 |
tctcctaatactttcttaccttgatctct |
13766307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1336 times since January 2019
Visitors: 3667