View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_2 (Length: 585)
Name: NF0544_low_2
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0544_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 11 - 137
Target Start/End: Original strand, 14203287 - 14203416
Alignment:
Q |
11 |
acaaaatagagaacgtgtcatttctgtctctgctactttctaatgatgcttaaaggctaaatccacttgccca---attattattatatcacgatcgttc |
107 |
Q |
|
|
||||||| || || ||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
14203287 |
acaaaatggataatgtgtcatttctgtctctactactttcttatgatgcttaaaggctaaagccacttgcccaattattattattatatcacgatcgttc |
14203386 |
T |
 |
Q |
108 |
gaaagtggtgtgattttacggttctaataa |
137 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
14203387 |
gaaagtggtgtgattttacggttctaataa |
14203416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University