View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_20 (Length: 337)
Name: NF0544_low_20
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 294
Target Start/End: Complemental strand, 13766669 - 13766386
Alignment:
| Q |
14 |
atatccaccataccagtcaaaagttcttcttcacagacaaaaaacaccgt--ctccttgcttgagccctttttgaatgtctatttcttaggtaggagaac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
13766669 |
atatccaccataccagtcaaaagttcttcctcatagacaaaaaacaccgtgtctccttgcttgagccctttttgaatatcgatttcttaggtaggagaac |
13766570 |
T |
|
| Q |
112 |
aattgaccaggacagcaggctacctgtaaacacacacactata-tccacgaccccatctcccctcaaaacaataatctcatttacagccacaaccccatc |
210 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||||||||| || |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13766569 |
aattgaccaggatagcaggctacttataaacacacacactctagtccacgaccccatctcccatcaaaacaataatctcatttatagccacaaccccatc |
13766470 |
T |
|
| Q |
211 |
tacatgttgtctccctctaacgaaggccgattggttggcgaaaataattttctccatgatatgagctaaacgcaaagcaaggac |
294 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766469 |
tacatgttgtctccctctaacgaaggtcgattggtttacgaaaataatcttctccatgatatgagctaaacgcaaagcaaggac |
13766386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 297 - 337
Target Start/End: Complemental strand, 13766347 - 13766307
Alignment:
| Q |
297 |
tcaggctaaaatcccctaaaagtatgggatattcaacctta |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766347 |
tcaggctaaaatcccctaaaagtatgggatattcaacctta |
13766307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1670 times since January 2019
Visitors: 3672