View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_22 (Length: 310)
Name: NF0544_low_22
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 2943673 - 2943841
Alignment:
| Q |
1 |
tattcttatttctgacgtgtatacagaaaatgttgatgtttatattatgagtannnnnnnnggtgttgttaatgaagccatattgaaggattctgattat |
100 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943673 |
tattgttatttctgacatgtatacagaaaatgttgatgtttatattatgagtattttttttggtgttgttaatgaagccatattgaaggattctgattat |
2943772 |
T |
|
| Q |
101 |
ggtgaagttgatagagctgagtgtcaatttactaccactggaactgttcttgacaatggaacacaggtt |
169 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943773 |
ggtgaagttgatagagctgagtgtcagtttactaccactggaactgttcttgacaatggaacacaggtt |
2943841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1602 times since January 2019
Visitors: 3672