View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_26 (Length: 251)
Name: NF0544_low_26
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 5190818 - 5190583
Alignment:
| Q |
1 |
caaaatttcgccataatta-agtataataacatttcaacctaattgcatacagtcaaaactacgtgcagttatgcagtcaaaacaattgcacgcagtttc |
99 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
5190818 |
caaaatttcgccataaatataata-aataacatttcaacataattgcatacagtcaaaagtacgtgcagttatgcagtcaaaacaactacacgcagtttc |
5190720 |
T |
 |
| Q |
100 |
aactgcaacatgcaaatttgattgcatgcaatctcgctttgaaatgaaagtacaatgtttcaataatttagcttttatgcaaaattgaaaagctttttat |
199 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5190719 |
aactgcaacatgcaaatttaattgaatgcaatttcgctttgaaatgaaagtacaatgtttcaataatttagcttttatgcaaaattgaaaagcttttaat |
5190620 |
T |
 |
| Q |
200 |
tttgcnnnnnnntatttttatgtctctaaattctaat |
236 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
5190619 |
tttgcaaaaaattatttttatgtctctaaattctaat |
5190583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University