View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0544_low_27 (Length: 250)

Name: NF0544_low_27
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0544_low_27
NF0544_low_27
[»] chr4 (2 HSPs)
chr4 (101-217)||(48411433-48411549)
chr4 (155-217)||(48418076-48418138)
[»] chr5 (1 HSPs)
chr5 (100-205)||(28396883-28396987)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 101 - 217
Target Start/End: Complemental strand, 48411549 - 48411433
Alignment:
101 gattcatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttata 200  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48411549 gattgatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttata 48411450  T
201 ttttgccgagggttctg 217  Q
    |||||||||||||||||    
48411449 ttttgccgagggttctg 48411433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 48418138 - 48418076
Alignment:
155 gtatatatgccctctcacagccaaagaatgaggtgaactgtttatattttgccgagggttctg 217  Q
    |||||||||| ||||||||||| ||||||||||  |||||||||||||| || ||||||||||    
48418138 gtatatatgctctctcacagcccaagaatgaggcaaactgtttatatttagctgagggttctg 48418076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 100 - 205
Target Start/End: Complemental strand, 28396987 - 28396883
Alignment:
100 agattcatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttat 199  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| |||||||||| |||||||||| |  ||||||||||    
28396987 agattgatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacaaaatatatg-cctctcacaggcaaagaatgaagcaaactgtttat 28396889  T
200 attttg 205  Q
    ||||||    
28396888 attttg 28396883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University