View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_27 (Length: 250)
Name: NF0544_low_27
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0544_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 101 - 217
Target Start/End: Complemental strand, 48411549 - 48411433
Alignment:
Q |
101 |
gattcatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttata |
200 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48411549 |
gattgatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttata |
48411450 |
T |
 |
Q |
201 |
ttttgccgagggttctg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
48411449 |
ttttgccgagggttctg |
48411433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 48418138 - 48418076
Alignment:
Q |
155 |
gtatatatgccctctcacagccaaagaatgaggtgaactgtttatattttgccgagggttctg |
217 |
Q |
|
|
|||||||||| ||||||||||| |||||||||| |||||||||||||| || |||||||||| |
|
|
T |
48418138 |
gtatatatgctctctcacagcccaagaatgaggcaaactgtttatatttagctgagggttctg |
48418076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 100 - 205
Target Start/End: Complemental strand, 28396987 - 28396883
Alignment:
Q |
100 |
agattcatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacagtatatatgccctctcacagccaaagaatgaggtgaactgtttat |
199 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||| | |||||||||| |
|
|
T |
28396987 |
agattgatggatgctgagaaggaaatatttgatatggtatacaacggtgaaaacaaaatatatg-cctctcacaggcaaagaatgaagcaaactgtttat |
28396889 |
T |
 |
Q |
200 |
attttg |
205 |
Q |
|
|
|||||| |
|
|
T |
28396888 |
attttg |
28396883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University