View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_3 (Length: 585)
Name: NF0544_low_3
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 3e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 25 - 137
Target Start/End: Original strand, 14203301 - 14203416
Alignment:
| Q |
25 |
gtgtcatttctgtctctgctactttctaatgatgcttaaaggctaaatccacttgccca---attattattatatcacgatcgttcgaaagtggtgtgat |
121 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14203301 |
gtgtcatttctgtctctactactttcttatgatgcttaaaggctaaagccacttgcccaattattattattatatcacgatcgttcgaaagtggtgtgat |
14203400 |
T |
 |
| Q |
122 |
tttacggttctaataa |
137 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14203401 |
tttacggttctaataa |
14203416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University