View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_4 (Length: 573)
Name: NF0544_low_4
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 91 - 433
Target Start/End: Original strand, 44734184 - 44734521
Alignment:
| Q |
91 |
cacaagaggtccgcacccaaaccaagcatccacagtggaagacccgttttggctaattgatgatcaaatcaaactactaagttagttaaaacacttgaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44734184 |
cacaagaggtccgcacccaaaccaagcatccaaagtggaagacccgttttggctaattgatgatcaaatcaaacta---agttagttaaaacacttgaaa |
44734280 |
T |
 |
| Q |
191 |
attcaactgacac--aacaaggttaatttggttctctttcttttggtttttgtttgtgttcaaggtactgttgttgtcgcgggaatgccactgctattta |
288 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44734281 |
actcaactgacacacaacaaggttaatttggttctctttcttttggtttttgtttgtgttcaaggttctgttgttgtcgcgggaatgccactgctattta |
44734380 |
T |
 |
| Q |
289 |
aagccatcacaaacgacttaaggacccttttcacacnnnnnnnnnnnnggactaatgagtaatgaatgaccccacctagcatattctttctttctatcct |
388 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44734381 |
aagtcatcacaaacgacttaaggacccttttcacacaaaaacaaaaaaggactaatgagt----aatgaccccacctagcatattctttctttctatcct |
44734476 |
T |
 |
| Q |
389 |
tttaacacatttacattgagagggatctattttattcctaaatgg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44734477 |
tttaacacatttacattgagagggatctattttattcctaaatgg |
44734521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 91 - 144
Target Start/End: Complemental strand, 2259703 - 2259650
Alignment:
| Q |
91 |
cacaagaggtccgcacccaaaccaagcatccacagtggaagacccgttttggct |
144 |
Q |
| |
|
||||||||||||| |||||| ||||||| ||| || || ||||||||||||||| |
|
|
| T |
2259703 |
cacaagaggtccggacccaatccaagcaaccaaagagggagacccgttttggct |
2259650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University