View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0544_low_5 (Length: 523)
Name: NF0544_low_5
Description: NF0544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0544_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 223 - 494
Target Start/End: Original strand, 39305122 - 39305399
Alignment:
| Q |
223 |
cacatacaattaatgtaatgnnnnnnngccacttttcaaaataaaatgatcttgaagcttttgtttgtcattg----tcgtgtaatattgacaaggaaaa |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39305122 |
cacatacaattaatgtaatgtttttt-gccacttttcaaaataaaatgatcttgaagcttttgtttgtcattgattgtcgtgtaatattgacaaggaaaa |
39305220 |
T |
|
| Q |
319 |
tgataaattgcacaaaagttgcactga---gtgaatatgcacaacaagtccaaattcaatcatatgccaatattcaaacagaatcactaaacgtacttat |
415 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39305221 |
tgataaattgcacaaaagttgcactaattagtgaatatgcacaacaagtctaaattcaatcatatgccaatattcaaacagaatcactcaacgtacttat |
39305320 |
T |
|
| Q |
416 |
gatggccaatgactcatgagaggattctggtttgttaattaagttacaccttttaaagaggcaaaattgatttcagagg |
494 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305321 |
gatggccaatgactcatgagaggattctggtttgttaattaagttacaccttttaaagaggcaaaattgatttcagagg |
39305399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 39304900 - 39305031
Alignment:
| Q |
1 |
atgactactgatcaaccatttacactacctatctctccaaattcgattcaaaaacaattacgacagcaagatcagattgattccatagggcattggtatg |
100 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39304900 |
atgactactgatcaaccatttccacttcctttctctccaaattcgattcaaaaacaattacgacagcaagatcagattgattccatagggcattggtatg |
39304999 |
T |
|
| Q |
101 |
aatgagtaagaccaagctaattttatgtttgg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39305000 |
aatgagtaagaccaagctaattttatgtttgg |
39305031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 327 times since January 2019
Visitors: 3649