View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_high_10 (Length: 419)
Name: NF0545_high_10
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 30 - 411
Target Start/End: Complemental strand, 44831358 - 44830977
Alignment:
| Q |
30 |
caagcaatgtcccccaaatatttgcattggcttcaatcggtatcttggtcacaaaagaatatgcttcactaacgtgtccacctcgagcgaggaggtccac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44831358 |
caagcaatgtcccccaaatatttgcattggcttcaattggtatcttggtcacaaaagaatatgcttcactaacgtgtccacctcgagcgaggaggtccac |
44831259 |
T |
|
| Q |
130 |
cacgcaagcaaactgttcaatagttggtttcataccatggattttctctattgaatcaaatatcttcagtccttcagctatgcggccagcgtgactgcaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44831258 |
cacgcaagcaaactgttcaatagttggtttcataccatggattttctctattgaatcaaatatcttcagtccttcagctatgcggccagcgtgactgcaa |
44831159 |
T |
|
| Q |
230 |
gcagataatatggaagtaaatataacatgatctggcttgattcccatattgagcatatgagaaaaagtcccaagtgctttttcactcatgccatgcatag |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44831158 |
gcagataatatggaagtaaatataacatgatctggcttgattcccatattgagcatatgagaaaaagtctcaagtgctttttcactcatgccatgcatag |
44831059 |
T |
|
| Q |
330 |
catacccaccaatcatagcagtaaacataaccagatccttatcaacacttgattgaaatatcttatatgcatagcctatgat |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44831058 |
catacccaccaatcatagcagtaaacataaccagatccttatcaacacttgattgaaatatcttatatgcatagcctatgat |
44830977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1267 times since January 2019
Visitors: 3667