View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_high_14 (Length: 379)
Name: NF0545_high_14
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 370
Target Start/End: Complemental strand, 2332058 - 2331691
Alignment:
Q |
1 |
cgttttgatccttgtctccccacaatcgtttctatttgacnnnnnnnc-atatattgtattactagttttaccttctcttttggttgtttggtagaggtt |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
2332058 |
cgttttgatccttgtctccccacaatcgtttctatttgaatttttttatatatattgtattactagttttaccttctctttaggttgtttggtagaggtt |
2331959 |
T |
 |
Q |
100 |
ttctcttgcaaaattacttatgtgcagttcttcgaatagctagtgttcatccggttcataactttagttacaaaataaattattaaaactgcccaaccgc |
199 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2331958 |
ttctcttgcaaaaatacttatgtgcagttcttcgaatagctagtgttcatccggttcataactttagttacaaaataaattattaaaactgcccaaccgc |
2331859 |
T |
 |
Q |
200 |
cattaatccaaatcatttttaaacgacaatgtttaggtacattcatgtgaagaactgagcgaatagtgtgcagggaacgatacctaagtattctcctttc |
299 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
2331858 |
cattaatccaaatcatttttaaacgacaatgtttaggtgcattcatgtgaaaaactgagcgaatagtgtgtagggaacgatacctaagtattctcctttc |
2331759 |
T |
 |
Q |
300 |
ttgtgttggttttcccttttaactgtttttcaccattattggtggtgatcattgttgtttcttagtattat |
370 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
2331758 |
ttgtgttggttttcccttttaactgtttttcacc---attggtggtgatcattgttgtttcttagtattat |
2331691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University