View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_high_20 (Length: 350)
Name: NF0545_high_20
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 30 - 337
Target Start/End: Complemental strand, 6010351 - 6010044
Alignment:
| Q |
30 |
ctttctaatctgatggcttgtttcataagcatctcaataagtgttacgatctgaacttctggtactttaactccatcagaaattgatttttcaattgcag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010351 |
ctttctaatctgatggcttgtttcataagcatctcaataagtgttatgatctgaacttctggtactttaactccatcagaaattgatttttcaattgcag |
6010252 |
T |
|
| Q |
130 |
atacttgttctgctagctgatcaagttggagagacacattattgatggcacgatttgcagtttggatcttagcattgatacgcatctggatgaaccttct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010251 |
atacttgttctgctagctgatcaagttggagagacacattatttatggcacgatttgcagtttggatcttagcattgatacgcatctggatgaaccttct |
6010152 |
T |
|
| Q |
230 |
ctcaatacttgaagcatcttgaatcaacaccaactttgacttgtctttgactccacatacatccaaatactctccattttcacgttcttttcctttgtat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6010151 |
ctcaatacttgaagcatcttgaatcaacaccaactttgacttgtctttgactccacatacatccaaaaactctccattttcacgttcttttcctttgtat |
6010052 |
T |
|
| Q |
330 |
atcactct |
337 |
Q |
| |
|
|||||||| |
|
|
| T |
6010051 |
atcactct |
6010044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1735 times since January 2019
Visitors: 3673