View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_high_25 (Length: 293)
Name: NF0545_high_25
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 84 - 283
Target Start/End: Original strand, 33117205 - 33117402
Alignment:
Q |
84 |
ggattaccagcttaaaaaataagtggaatgaat--------tgtgaatataaaattatactactcaacatttggtaaattagagctttcactgtttcaca |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33117205 |
ggattaccagcttaaaaaataagtggaatgaatatccacattgtgaatataaaattatgctactcaacatttggtaaattagagctttcactgtttcaca |
33117304 |
T |
 |
Q |
176 |
tctcaaatatctaatcgttttgtctttttgttttcaatattctttattcacgctcattcacaatgatggcaaggattcttgcttggtgtttactatactt |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33117305 |
tctcaaatatctaatcgttttgtctttttgttttcaatattcttt----------attcacaatgatggcaaggattcttgcttggtgtttactatactt |
33117394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 33117131 - 33117163
Alignment:
Q |
13 |
gtttatgactattttcttaggatctgcattaat |
45 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
33117131 |
gtttatgactattttcttaggatctgcattaat |
33117163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University